Mol Biol Rep DOI 10.1007/s11033-013-2973-9 Expression analysis nine small heat shock protein genes from Tamarix hispida in response to different abiotic stresses and abscisic acid treatment Guiyan Yang • Yucheng Wang • Kaimin Zhang Caiqiu Gao • Received: 24 November 2012 / Accepted: 24 December 2013 Ó Springer Science+Business Media Dordrecht 2014 Abstract Heat shock proteins (HSPs) play important roles in protecting plants against environmental stresses. Furthermore, small heat shock proteins (sHSPs) are most ubiquitous HSP subgroup with molecular weights ranging from 15 to 42 kDa. In this study, nine sHSP genes (designated as ThsHSP1–9) were cloned from Tamarix hispida. Their expression patterns in response to cold, heat shock, NaCl, PEG and abscisic acid (ABA) treatments were investigated in roots and leaves T. hispida by real-time RT-PCR analysis. The results showed that most nine ThsHSP genes were expressed at higher levels in roots than in leaves under normal growth condition. All ThsHSP genes were highly induced under conditions cold (4 °C) and different heat shocks (36, 40, 44, 48 and 52 °C). Under NaCl stress, all nine ThsHSPs genes were up-regulated at least one stress time-point in both roots and leaves. Under PEG and ABA treatments, nine ThsHSPs showed various expression patterns, indicating complex regulation pathway among these genes. This study represents an important basis for elucidation ThsHSP gene function and provides essential information that can be used for stress tolerance genetic engineering in future studies. Keywords ABA Á Abiotic stress Á Expression pattern Á Heat shock protein Á Tamarix hispida Electronic supplementary material The online version this article (doi:10.1007/s11033-013-2973-9) contains supplementary material, which is available to authorized users. G. Yang Á Y. Wang Á K. Zhang Á C. Gao (&) State Key Laboratory Tree Genetics and Breeding, Northeast Forestry University, 26 Hexing Road, Harbin 150040, China e-mail: gaocaiqiu@yahoo.com Abbreviations ABA Abscisic acid sHSP Small heat shock protein PEG Polyethylene glycol Introduction Heat shock proteins (HSPs) are known to be induced following exposure to increasing temperature, and were first discovered in Drosophila in 1962. These proteins have subsequently been reported in many organisms, including plants [1]. Plant HSPs are generally divided into five evolutionarily conserved groups according to molecular mass: small HSPs (sHSPs), HSP60, HSP70, HSP90 and HSP100 [2]. sHSPs are most ubiquitous HSP subgroup with molecular weights ranging from 15 to 42 kDa [3], which includes an evolutionarily divergent N-terminal region, followed by conserved a-crystallin domain (ACD) approximately 90 amino acid residues homologous to alpha-crystallin proteins vertebrate eye lens [4] and short C-terminal tail [5]. sHSPs exist in many plants and play an important role in growth, defense and stress resistance [6]. In rice (Oryza sativa L. ssp. japonica), there are 23 sHsp genes (16 cytoplasmic/ nuclear, 2 ER, 3 mitochondrial, 1 plastid and 1 peroxisomal), 19 which have been shown by microarray and RT-PCR analyses to be upregulated by high temperature stress [7]. In Arabidopsis thaliana, 13 sHSP genes were classified as CI, CII and CIII [8, 9], three which (AtHsp17.4, AtHsp17.6 and AtHsp17.7) accumulated during middle stage seed maturation, with concentrations maintained at high levels during late stage and in immature dry seeds [10]. 123 Mol Biol Rep DcHsp17.7, sHSP in carrot (Daucus carota L.), performs molecular chaperone activity in salt-stressed transgenic E. coli, and is involved in tolerance not only to thermal stresses but also to other abiotic stresses, such as salinity [11]. JcHSP-1 and JcHSP-2, identified and characterized from developing seeds promising biodiesel feed stock plant Jatropha curcas, play an important role in cell protection and seed development during seed maturation [12]. Overexpression alfalfa mitochondrial HSP23 in prokaryotic and eukaryotic model systems confers enhanced tolerance to salinity and arsenic stress [13]. Tamarix hispida is shrub or small tree growing mainly in arid and semi-arid regions, which exhibits tolerance to high temperature, salt and drought. These characteristics make T. hispida an ideal model plant to study physiological and molecular mechanisms trees responses to various stresses and for cloning tolerance related genes. In present study, nine ThsHSP genes were cloned from T. hispida. To better understand roles ThsHSP genes in abiotic stress tolerance, expression profiles these nine ThsHSP genes were investigated by real-time RT-PCR in root and leaf tissue T. hispida in response to salt (NaCl), drought (PEG), salt and drought together (NaCl and PEG), hormone (abscisic acid, ABA), cold (4 °C) and heat (36, 40, 44, 48 and 52 °C) stresses. Our study represents foundation for elucidation roles ThsHSP genes in stress tolerance in plants. Materials and methods Cloning and identification nine ThsHSP genes Using Solexa technology, seven transcriptomes were constructed comprising four transcriptomes from root tissues T. hispida treated with 0.3 M NaHCO3 for 0, 12, 24 and 48 h and three from leaves treated with 0.3 M NaHCO3 for 0, 12 and 24 h. total 94,361 non-redundant unigenes (NRUs) were assembled using TGI Clustering tools [14], and all NRUs were subjected to BLASTX analysis against protein databases, NR and Swiss-Prot, to search for similarities. Unigenes with BLASTX E-values exceeding 10-5 were discarded during functional annotation. The sHSP genes were searched and identified according to functional annotations NRUs. Sequence alignment and phylogenetic analysis Nine unique sHSP genes with completed ORFs from 33 putative ThsHSP unigenes were obtained (designated as ThsHSP1–ThsHSP9). The Compute pI/MW tool (http:// www.expasy.org/tools/protparam.html) was used to analysis molecular weight (MW) and isoelectric point (pI) predictions for every deduced ThsHSP. All nine ThsHSP genes were aligned by ClustalX. For phylogenetic analysis, nine ThsHSP proteins from T. hispida, phylogenetic tree reconstruction was constructed employing neighbor-joining (NJ) method in MEGA 4.0. Furthermore, classification nine ThsHSP genes was carried out according to phylogenetic tree using classification and designation method Bondino et al. [15]. Plant material, growth conditions and stress treatments RNA isolation and reverse-transcription (RT) Tamarix hispida seedlings were planted in plastic pots (16 9 16 9 16 cm3) containing mixture turf peat and sand (2:1 v/v) in greenhouse at 24 °C and 70–75 % relative humidity with light/dark cycles 14/10 h (lights on at 7.00 AM). After two months, these seedlings were used for following experimental analyses. For NaCl, PEG and ABA treatments, seedlings were well watered at roots with 0.4 M NaCl, 20 % (w/v) polyethylene glycol 6000 (PEG6000), 0.4 M NaCl and 20 % PEG6000, or 100 lM ABA for 0, 3, 6, 9, 12 and 24 h, respectively. For cold stress, seedlings were subjected to 4 °C for 24 h, for heat stress, seedlings were independently exposed to 36, 40, 44, 48, 52 °C for 2 h. The seedlings under normal physiological conditions (watered with water and placed at 24 °C) were as control. After each treatment, three samples (the leaves or roots from at least 20 seedlings each sample) were independently harvested and prepared for real-time PCR. Supplementary Fig. 1 showed growth state T. hispida seedlings used in this assay. Total RNA was isolated from leaves or roots using CTAB method [16] and digested with DNase I (TaKaRa, USA) to remove any DNA residue. The quality all RNAs was confirmed by assessment purity RNA samples by 260/280 nm ratio and by 1 % agarose gel electrophoresis ethidium bromide (EB) stained samples. Samples were quantified by absorbance at 260 nm. Approximately 0.5 lg DNaseI-treated total RNA was reverse-transcribed into cDNA using an oligodeoxythymidine primer and six random primers in final reaction volume 10 lL following PrimeScriptTM RT reagent Kit protocol (TaKaRa). The synthesized cDNAs were diluted to 100 lL with sterile water and used as templates for real-time RT-PCR analysis. 123 Real-time quantitative RT-PCR Real-time RT-PCR was performed using MJ OpticonTM2 machine (Biorad, Hercules, CA, USA) with using real- Mol Biol Rep Table 1 Primer sequences used for quantitative RT-PCR analysis Gene Forward Primers (50 –30 ) Reverse Primers (50 –30 ) ThsHSP1 GCCTCAAGAAGCCAAGGTGG ACGGCGCATGGTTCGCATCG ThsHSP2 ACAGCCTCTGCGCTCCCAAC GGACGCTGCAGTTCGGGCT ThsHSP3 AGCCGTCGAAACCCAAGGCTC AACCTTCCACCACCATCACC ThsHSP4 TTGAGTCAGCCACTGTTTCG TAGTGGTAGTGTTAGCATCT ThsHSP5 AAGCGCACATAATCAAGGCGGA TCCATCGAAGCCTTGACATCCT ThsHSP6 TCCGAAGACGCCAATTCTCC ACGGAGGTGCCATTTCCCGC ThsHSP7 AAGCACGCCTGCAGACATCAAA ACGCCATCTTTCTCTTCATCCC ThsHSP8 AGCTTCTTTGGTGGCCTGCG GAGATCAGCCTTGAATATGTG ThsHSP9 CGTGGCTTAGGCAGTGCGGT AGATCGACTCTAGTCGAATAC Actin AAACAATGGCTGATGCTG ACAATACCGTGCTCAATAGG a-tubulin b-tubulin CACCCACCGTTGTTCCAG GGAAGCCATAGAAAGACC ACCGTCGTCATCTTCACC CAACAAATGTGGGATGCT Table 2 Characteristics nine ThsHSP from T. hispida Gene GenBank accession number Type Deduced number amino acid Isoelectric point Molecular mass (kDa) ThsHSP1 JX482105 CIII 231 5.83 25.69 ThsHSP2 JX482106 CIII 245 9.01 27.76 ThsHSP3 JX482107 CI SII 169 4.67 19.28 ThsHSP4 JX482108 CI SII 154 6.66 17.04 ThsHSP5 JX482109 CI 163 5.71 18.41 ThsHSP6 JX482110 CI SII 174 6.60 19.33 ThsHSP7 JX482111 CII 157 5.93 17.67 ThsHSP8 JX482112 CI 162 6.86 18.45 ThsHSP9 JX482113 CIII 127 5.33 14.41 time PCR MIX Kit (SYBR Green as fluorescent dye, Toyobo). The gene and internal control primers chosen for real-time RT-PCR are shown in Table 1, in which alpha tubulin (FJ618518), beta tubulin (FJ618519), and Actin (FJ618517) genes were used as internal controls (reference genes) to normalize total RNA amount present in each reaction. The 20 lL reaction mixture contained 10 lL SYBR Green Real-time PCR Master Mix (Toyobo), 2 lL cDNA template (equivalent to 100 ng total RNA), 0.5 lM each forward and reverse primer (Table 1). The following cycling parameters were applied for amplification: 94 °C for 30 s followed by 44 cycles at 94 °C for 12 s, 60 °C for 30 s, 72 °C for 40 s, and 1 s at 81 °C for plate reading. To ensure reproducibility real-time PCR results, three independent experiments were carried out. The relative expression levels nine ThsHSP genes was calculated according to 2-DDCt formula [17]. The SPSS software package (SPSS, Chicago, IL, USA) was used to analyze data. The expression patterns ThsHSP genes were clustered under various stress time points for each treatment using Cluster 3.0. Results Isolation and characterization nine ThsHSP genes Nine ThsHSP genes with complete open reading frames (ORFs) were identified from seven T. hispida transcriptomes. The ORFs encoded deduced polypeptides 127–245 amino acids, with predicted molecular mass 14.4–27.7 kDa and pI 5.33–9.01 (Table 2). Multiple alignments and phylogenetic relationships among nine ThsHSP proteins were performed (Supplementary Figs. 2, 3). The results showed that these nine ThsHSP protein sequences shared homology from 14 to 82 %, with ThsHSP5 and ThsHSP8 sharing highest sequence homology (82 %) (Table 3). The results BALASX with protein database in NCBI showed that 9 ThsHSP proteins were all ACD sHSP. ACD HSP proteins were classified into Monophyletic clade I which contains cytosolic CI, CII and CIII sHSPs, even they maybe divided into smaller classes (such as CISI) based on phylogenetic analysis by Bondino et al. [15]. Nine ThsHSP proteins were 123 Mol Biol Rep Table 3 Sequence similarity among 9 ThsHSP (%) Gene ThsHSP1 ThsHSP2 ThsHSP3 ThsHSP4 ThsHSP2 31 ThsHSP3 14 20 ThsHSP4 18 16 22 ThsHSP5 21 25 33 26 ThsHSP6 16 17 25 29 30 ThsHSP7 19 22 15 26 29 25 ThsHSP8 20 19 31 31 82 33 29 ThsHSP9 29 33 27 22 28 24 22 phylogenetic analysed with proteins classified in their groups, results indicated that these nine ThsHSPs were belonged to different classes (Table 1). In particular, ThsHSP1, 2 and 9 were belong to CIII type, ThsHSP3, 4 and 6 were to CI SII type and ThsHSP5 and 8 were CI type; while ThsHSP7 belonged to CII type. Relative expression levels ThsHSP genes in roots and leaves Relative expression levels nine ThsHSPs in roots and leaves under normal growth conditions were analyzed by real-time RT-PCR. To compare expression levels ThsHSPs, transcription level Actin gene was arbitrarily assigned as 100 (Table 4). The results showed that all ThsHSP genes (except ThsHSP9) were mainly expressed in roots rather than in leaves. In roots, most abundant gene was ThsHSP1, with transcription level 239.8 relative to that Actin, although level was just 1.6 in leaves. Expression patterns ThsHSP genes in response to various stresses In order to investigate expression profiles ThsHSPs in T. hispida in response to various abiotic stresses, realtime RT-PCR analysis was carried out. ThsHSP5 ThsHSP6 ThsHSP7 ThsHSP8 30 Table 4 Relative abundance nine ThsHSP genes in T. hispida Gene Relative abundance Roots Leaves ThsHSP1 239.8 1.6 ThsHSP2 24.2 1.5 ThsHSP3 50.9 5.3 ThsHSP4 29.9 3.6 ThsHSP5 54.7 4.8 ThsHSP6 16.5 0.8 ThsHSP7 ThsHSP8 13.1 7.7 0.1 2.5 ThsHSP9 15.1 37.4 Actin 100 100 The transcription levels were plotted relative to expression Actin gene, and transcription levels Actin gene in root and leaf were all assigned as 100 those induced by other treatments. The transcription levels ThsHSP1, ThsHSP5 and ThsHSP6 all reached maximum following exposure to 44 °C, while ThsHSP2 and ThsHSP4 reached peak expression at 40 °C. ThsHSP3, ThsHSP8 and ThsHSP9 exhibited highest expression levels at 36 °C. ThsHSP7 reached peak expression at 52 °C stress (Fig. 1). NaCl stress Temperature treatments These nine ThsHSP genes were all upregulated by cold and high temperature treatments in roots and leaves. In roots, ThsHSP1, ThsHSP2, ThsHSP3, ThsHSP4 and ThsHSP9 shared similar expression patterns, reaching peak expression levels at 52 °C (Fig. 1). The highest expression levels ThsHSP5 and ThsHSP6 occurred following treatment at 4 °C, followed by levels detected in response to treatment for 52 °C. ThsHSP7 and ThsHSP8 exhibited highest expression levels at 44 °C (Fig. 1). In leaves, all nine ThsHSPs were induced at 4 °C, albeit at lower levels than 123 In roots, ThsHSP3 and ThsHSP4 expression patterns were consistent. In generally, expression levels were slowly increasing with stress time. At beginning stress time (3 h), expressions were inhibited, but no significant difference compared with control. At other times they were upregulated. ThsHSP8 and ThsHSP9 expressions were obviously induced at 3 h. However, they were highly downregulated at 12 h, when they reached their lowest expression level (Fig. 2). The other 5 ThsHSP genes were downregulated at early stress period (12 h), with expression levels subsequently increased at later stage. Mol Biol Rep Cold and heat stress 24 4 36 40 44 48 52 Relative expression level 20 16 12 8 4 0 ThsHSP1 ThsHSP2 ThsHSP3 ThsHSP4 ThsHSP5 ThsHSP6 ThsHSP7 ThsHSP8 ThsHSP9 ThsHSP8 ThsHSP9 Genes Roots B 32 4 36 40 44 48 52 Relative expression level 28 24 20 16 12 8 4 0 ThsHSP1 ThsHSP2 ThsHSP3 ThsHSP4 ThsHSP5 ThsHSP6 ThsHSP7 Genes Leaves Fig. 1 Transcription analysis nine ThsHSPs responding to cold and heat shock in roots and leaves. The relative transcription level = transcription level under stress treatment/transcription level under control condition (0 h). All relative transcription levels were log2-transformed. Roots; b Leaves Following NaCl stress for 24 h, all ThsHSP genes were upregulated, with 6 ThsHSP genes reaching peak expression level at this time-point. In leaves, ThsHSP8 and ThsHSP9 were downregulated after NaCl stress for 0–12 h, and were upregulated at 24 h. The remaining 7 ThsHSP genes were predominantly upregulated during stress period. Interestingly, all nine genes reached highest transcription levels at 24 h. The most highly induced gene was ThsHSP3 (337.8-fold at 24 h) (Fig. 2). PEG stress In roots, all ThsHSP genes (except ThsHSP6) were mainly downregulated under PEG stress, especially ThsHSP1, ThsHSP7, ThsHSP8 and ThsHSP9, for which highly downregulated expression was detected during PEG stress period, with lowest expression levels at 9 h. Compared with expression levels at 0 h, ThsHSP1, ThsHSP7, ThsHSP8 and ThsHSP9 expression was 123 Mol Biol Rep 0.4 M NaCl 6 3h 6h 9h 12 h 24 h Relative expression level 4 2 0 -2 -4 -6 ThsHSP1 ThsHSP2 ThsHSP3 ThsHSP4 ThsHSP5 ThsHSP6 ThsHSP7 ThsHSP8 ThsHSP9 ThsHSP7 ThsHSP8 ThsHSP9 Genes Roots B 3h 10 6h 9h 12 h 24 h Relative expression level 8 6 4 2 0 -2 -4 ThsHSP1 ThsHSP2 ThsHSP3 ThsHSP4 ThsHSP5 ThsHSP6 Genes Leaves Fig. 2 Transcription analysis nine ThsHSPs responding to NaCl in roots and leaves. The relative transcription level = transcription level under stress treatment/transcription level under control condition (0 h). All relative transcription levels were log2-transformed. Roots; b Leaves decreased by 10.2, 1.4, 18.9 and 2.1 % at 9 h, respectively (Fig. 3). In leaves, expression levels nine ThsHSP genes were divided into two main groups (Supplementary Fig. 4). One group comprised ThsHSP1, ThsHSP2, ThsHSP3, ThsHSP5, ThsHSP6 and ThsHSP7, which were induced at most stress time-points. The other group comprised ThsHSP4, ThsHSP8 and ThsHSP9, which were mainly downregulated (Fig. 3). 123 NaCl and PEG stress In roots, all ThsHSP genes were highly up-regulated at all treated time points. However, their induced expression patterns and levels were diversity. ThsHSP2 induced expression level was highest (15.6–133.6-fold control). And maximum expression level was at 12 h. At 9 h, expression also was more than 102-fold. ThsHSP1, Mol Biol Rep 20% PEG6000 Relative expression level 3h 4 6h 9h 12 h 24 h 2 0 -2 -4 -6 -8 ThsHSP1 ThsHSP2 ThsHSP3 ThsHSP4 ThsHSP5 ThsHSP6 ThsHSP7 ThsHSP8 ThsHSP9 ThsHSP7 ThsHSP8 ThsHSP9 Genes B 6 Relative expression level Roots 4 3h 6h 9h 12 h 24 h 2 0 -2 -4 ThsHSP1 ThsHSP2 ThsHSP3 ThsHSP4 ThsHSP5 ThsHSP6 Genes Leaves Fig. 3 Transcription analysis nine ThsHSPs responding to PEG in roots and leaves. The relative transcription level = transcription level under stress treatment/transcription level under control condition (0 h). All relative transcription levels were log2-transformed. Roots; b leaves ThsHSP6, ThsHSP7 and ThsHSP9 reached peak at 9 h, while ThsHSP3, ThsHSP4, ThsHSP5 and ThsHSP8 displayed their peak at 3 h or 24 h. In leaves, all ThsHSP genes (except ThsHSP4) also were highly upregulated at all stress time points. And other 7 ThsHSP genes reached their highest induced expression levels at 3 h. The most highly induced folds were 24.4–236.3. The ThsHSP4 expression was downregulated at beginning stress period (3 h). At other stress times, expression levels ThsHSP we higher than control and highest expression level was 33.8-fold control (12 h) (Fig. 5). ABA treatment In roots, all nine ThsHSPs were notably downregulated at most time-points. In particular, ThsHSP 1, 4, and 7 were downregulated during stress period. Furthermore, expression levels ThsHSP 7 and 9 at 12 h were decreased by 2.7 and 2.5 % levels detected at 0 h. In leaves, expression patterns ThsHSP genes were generally divided into three groups. One group contained ThsHSP 8 and 9, for which downregulated expression was detected at most time-points. The second group consisted 123 Mol Biol Rep 100 µM ABA Relative expression level 3h 4 6h 9h 12 h 24 h 2 0 -2 -4 -6 ThsHSP1 ThsHSP2 ThsHSP3 ThsHSP4 ThsHSP5 ThsHSP6 ThsHSP7 ThsHSP8 ThsHSP9 ThsHSP7 ThsHSP8 ThsHSP9 Genes Roots B 3h 6 6h 9h 12 h 24 h Relative expression level 4 2 0 -2 -4 -6 ThsHSP1 ThsHSP2 ThsHSP3 ThsHSP4 ThsHSP5 ThsHSP6 Genes Leaves Fig. 4 Transcription analysis nine ThsHSPs responding to abscisic acid (ABA) in roots and leaves. The relative transcription level = transcription level under stress treatment/transcription level under control condition (0 h). All relative transcription levels were log2-transformed. Roots; b leaves ThsHSP2 and ThsHSP4, for which expression levels were not noticeably altered during stress period. The remaining ThsHSP genes constituted third group, which were mainly upregulated after ABA treatment (Fig. 4). exposed to heat [6]. However, it is interesting that, in this study, nine ThsHSP genes were showed varied transcript abundance in roots and leaves under normal conditions. Eight ThsHSP genes were highly expressed in roots compared with leaves, while expression level ThsHSP9 was higher in leaves than in roots (Table 4), suggesting different ThsHSPs genes play different role in roots and leaves. The accumulation extent sHSP under heat stress depends on temperature and duration stress Discussion Most sHSPs cannot be detected in vegetative tissues under normal growth conditions, but are rapidly produced 123 Mol Biol Rep period [18]. And sHsps may be important for plant recovery after heat stress has been released [19]. Definitely, when T. hispida seedlings were treated with various temperatures, all ThsHSP genes were induced remarkably. Especially when temperature higher than 44 °C, they were induced more notable. The results are consistent with reports that elevated temperature enhances HSP genes expression levels in many other plant species [20–22]. Guan et al. [23]. showed that eight sHSP-CI genes in rice (Oryza sativa Tainung No. 67) were induced strongly after 2-h heat shock treatment. However, sHSP genes on chromosome 3 were induced rapidly at 32 and 41 °C, whereas those on chromosome 1 were induced slowly by similar conditions. With onset treatment at 41 °C some sHSP-CI genes were induced within only 5 min, although expression all nine sHSP-CI genes was detected after 15 min. In Arabidopsis, heat stress treatment at 40 °C, induced expression some HSP70s by 2–20-fold [21]. Zou et al. [24] also showed that transcripts all nine OsHSP genes investigated in rice increased under heat shock treatment. These results demonstrate that heat shock is basic stimulus for response sHSP. However, heat shock is not only stimulus to trigger expression and protein synthesis sHSP. Some sHsps are in response to osmotic and salt stress. The expression OsHSP23.7 in rice (O. sativa L.) was increased during salt stress treatment, and OsHSP24.1 gene was enhanced following treatment with 10 %PEG [24]. Upon exposure to 0.3 M NaCl, DcHsp17.7 protein level carrot (Daucus carota L.), increased dramatically in leaf tissue (14-fold) [11]. AtHSP17.6A and At-HSP17.6-II were induced by 0.2 M NaCl and 20 % PEG with similar kinetics in Arabidopsis [25]. In Rosa chinensis, RcHSP17.8 was induced by 0.3 M NaCl, 10 % polyethylene, glycol and 0.4 M mannitol [26], OsHsfC1b was induced in O. sativa roots after 30 min salt stress, while expression was downregulated in roots by mannitol treatment [27]. In current study, under NaCl treatment, ThsHSP genes showed various expression patterns at treat points in roots, while in leaves, expression these nine ThsHSPs were mainly up-regulated and showed their NaCl and PEG treatment Relative expression level 3h 8 6h 9h 12h 24h 6 4 2 0 ThsHSP1 ThsHSP2 ThsHSP3 ThsHSP4 ThsHSP5 ThsHSP6 ThsHSP7 ThsHSP8 ThsHSP9 Genes Roots Relative expression level B 3h 8 6h 9h 12h 24h 4 0 -4 ThsHSP1 ThsHSP2 ThsHSP3 ThsHSP4 ThsHSP5 ThsHSP6 ThsHSP7 ThsHSP8 ThsHSP9 Genes Leaves Fig. 5 Transcription analysis nine ThsHSPs responding to coNaCl and PEG treatment in roots and leaves. The relative transcription level = transcription level under stress treatment/transcription level under control condition (0 h). All relative transcription levels were log2-transformed. Roots; b Leaves 123 Mol Biol Rep maximum expression level at 24 h. Under PEG stress, expression ThsHSPs were showed similar patters to NaCl (Figs. 2, 3). Furthermore, when treated with NaCl and PEG together, T. hispida showed higher and more stable inducement in roots and leaves (Fig. 5), suggesting that salt and/or PEG may share same induce pathway for ThsHSPs. Exogenous ABA is an important stimulus for sHSP. Previous reports have shown that some HSPs are ABA responsive genes, which occur in many species including tobacco [28], sunflower [29, 30], bean [31], wheat [32] and maize [33]. In current study, all ThsHSPs were downregulated in roots under ABA treatment. In leaves, expression patterns these genes could be divided into distinct three types, including induced, decreased and no obvious change. These results suggest that expression ThsHSP genes is involved in ABA-dependent stress signal transduction pathways. However, these genes may play different roles in ABA signaling pathway in stress responses in root and leaves. The expression patterns ThsHSP genes under various abiotic stresses indicated that ThsHSP genes were induced by heat shock, NaCl, PEG and ABA, suggesting ThsHSP genes maybe involve in T. hispida responding to these stresses. But tolerance mechanisms ThsHSPs response to these stresses were still unknown. The previous study showed that half-life HSP70 mRNA after transcription was only 15 to 30 min, but under heat shock conditions it is able to keep for 4 h, and inferred that HSP70 was aimed to keep organism from harm by enhancing stability and preferential translation mRNA [34]. Given fact that sHSP and HSP70 were all belong to HSP superfamily, ThsHSPs may be concern in such mechanism as HSP70. Some sHSPs have been suggested to act as molecular chaperone in vitro and in vivo [35, 36], and sHSP chaperone activities are ATP independent [37], i.e., sHSPs can keep them in state competent, selectively bind nonnative proteins and avoid aggregation for ATP dependent refolding by other chaperones [36]. Experiments have demonstrated that sHSPs from diverse organisms are particularly effective in avoiding thermal aggregation other proteins by an ATP-independent mechanism [37]. Furthermore, abiotic stress including heat, osmotic and salt are always accompanied to generate with oxidative stress, while an increasing proper level reactive oxygen species (ROS) at least in part in favour mediating various environmental stresses [38]. HSP70 acts as chaperone by effectively controlling release protein binding and correctly folding nascent polypeptide chains, selectively participating in degradation some damage protein and membrane transport protein [39]. Overexpression rice mitochondrial HSP70 inhibits heat and oxidation induced apoptosis, and this inhibition is achieved by maintaining 123 stability mitochondrial membrane potential and inhibiting reactive oxygen diffusion [40]. Under combined drought and high temperature stresses, HSP101 can increase corn leaves antioxidant defense capacity [41]. In current study, nine ThsHSP genes were induced under NaCl, PEG, ABA, heat shock treatments, however, whether these nine ThsHSP genes are involved with ROS scavenging and how they interact, whether they are ATPdependent regulation genes remain to be answered, and better understanding mechanism ThsHSP might provide further powerful information to modify their stress tolerance. In conclusion, nine ThsHSP genes with complete ORFs were cloned from T. hispida. Expression analysis showed that these ThsHSP genes were expressed more highly in roots than in leaves, suggesting that they may play more major roles in roots than in leaves. Furthermore, these nine ThsHSPs are all associated with heat shock, PEG and NaCl stresses and are involved in ABA signaling pathway, and displayed complex regulation pathway, indicating that some these genes have potential roles in genetic improvement abiotic stress tolerance in plants. Our study may lay an important basis for revealing function ThsHSP in response to abiotic stress and provides essential information for selection candidate genes used for stress tolerance genetic engineering in future studies. Acknowledgments This work has been supported by Program for New Century Excellent Talents in University (NCET-13-0709), Specialized Research Fund for Doctoral Program Higher Education China (No. 20100062120001), and National Natural Science Foundation China (No. 31270708). References 1. Vierling E (1991) The roles heat shock proteins in plants. Annu Rev Plant Biol 42(1):579–620 2. Krishna P (2004) Plant responses to heat stress plant responses to abiotic stress. In: Hirt H, Shinozaki K (eds) Topics in current genetics, vol 4. Springer, Berlin, pp 73–101. doi:doi:10.1007/ 978-3-540-39402-0_4 3. Lee GJ, Roseman AM, Saibil HR, Vierling E (1997) small heat shock protein stably binds heat-denatured model substrates and can maintain substrate in folding-competent state. EMBO J 16(3):659–671. doi:10.1007/978-3-540-39402-0_4 4. Jong WW, Caspers G-J, Leunissen JAM (1998) Genealogy a-crystallin: small heat-shock protein superfamily. Int J Biol Macromol 22(3–4):151–162. doi:10.1016/s0141-8130(98)00013-0 5. De Jong W, Leunissen J, Voorter C (1993) Evolution alpha-crystallin/small heat-shock protein family. Mol Biol Evol 10(1):103–126 6. Sun W, Van Montagu M, Verbruggen N (2002) Small heat shock proteins and stress tolerance in plants. Biochim Biophys Acta 1577(1):1 7. Sarkar NK, Kim YK, Grover (2009) Rice sHsp genes: genomic organization and expression profiling under stress and development. BMC Genom 10(1):393 Mol Biol Rep 8. Scharf KD, Siddique M, Vierling E (2001) The expanding family Arabidopsis thaliana small heat stress proteins and new family proteins containing a-crystallin domains (ACD proteins). Cell Stress Chaperones 6(3):225 9. Ma C, Haslbeck M, Babujee L, Jahn O, Reumann S (2006) Identification and characterization stress-inducible and constitutive small heat-shock protein targeted to matrix plant peroxisomes. Plant Physiol 141(1):47–60 10. Wehmeyer N, Hernandez LD, Finkelstein RR, Vierling E (1996) Synthesis small heat-shock proteins is part developmental program late seed maturation. Plant Physiol 112(2):747–757 11. Song NH, Ahn YJ (2010) DcHsp17. 7, small heat shock protein from carrot, is upregulated under cold stress and enhances cold tolerance by functioning as molecular chaperone. HortScience 45(3):469–474 12. Omar SA, Fu Q-T, Chen M-S, Wang G-J, Song S-Q, Elsheery NI, Xu ZF (2011) Identification and expression analysis two small heat shock protein cDNAs from developing seeds biodiesel feedstock plant Jatropha curcas. Plant Sci 181(6):632–637. doi:10.1016/j.plantsci.2011.03.004 13. Lee K-W, Cha J-Y, Kim K-H, Kim Y-G, Lee B-H, Lee S-H (2012) Overexpression alfalfa mitochondrial HSP23 in prokaryotic and eukaryotic model systems confers enhanced tolerance to salinity and arsenic stress. Biotechnol Lett 34(1):167–174. doi:10.1007/s10529-011-0750-1 14. Pertea G, Huang X, Liang F, Antonescu V, Sultana R, Karamycheva S, Lee Y, White J, Cheung F, Parvizi B (2003) TIGR gene indices clustering tools (TGICL): software system for fast clustering large EST datasets. Bioinformatics 19(5):651–652 15. Bondino H, Valle E, ten Have (2012) Evolution and functional diversification small heat shock protein/a-crystallin family in higher plants. Planta 235(6):1299–1313. doi:10.1007/s00425011-1575-9 16. Chen GYJ, Jin S, Goodwin PH (2000) An improved method for isolation total RNA from Malva pusilla tissues infected with colletotrichum gloeosporioides. J Phytopathol 148(1):57–60. doi:10.1046/j.1439-0434.2000.00470.x 17. Livak KJ, Schmittgen TD (2001) Analysis relative gene expression data using real-time quantitative PCR and 2-DDCT method. Methods 25(4):402–408. doi:10.1006/meth.2001.1262 18. Howarth C (1991) Molecular responses plants to an increased incidence heat shock. Plant Cell Environ 14(8):831–841 19. DeRocher AE, Helm KW, Lauzon LM, Vierling E (1991) Expression conserved family cytoplasmic low molecular weight heat shock proteins during heat stress and recovery. Plant Physiol 96(4):1038–1047 20. Hsieh MH, Chen JT, Jinn TL, Chen YM, Lin CY (1992) class soybean low molecular weight heat shock proteins immunological study and quantitation. Plant Physiol 99(4):1279–1284 21. Sung DY, Vierling E, Guy CL (2001) Comprehensive expression profile analysis Arabidopsis Hsp70 gene family. Plant Physiol 126(2):789–800 22. Koo H, Xia X, Hong C (2003) Genes and expression pattern tobacco mitochondrial small heat shock protein under high-temperature stress. J Plant Biol 46(3):204–210. doi:10.1007/ bf03030450 23. Guan J-C, Jinn T-L, Yeh C-H, Feng S-P, Chen Y-M, Lin C-Y (2004) Characterization genomic structures and selective expression profiles nine class I small heat shock protein genes clustered on two chromosomes in rice (Oryza sativa L.). Plant Mol Biol 56(5):795–809. doi:10.1007/s11103-004-5182-z 24. Zou J, Liu A, Chen X, Zhou X, Gao G, Wang W, Zhang X (2009) Expression analysis nine rice heat shock protein genes under abiotic stresses and ABA treatment. J Plant Physiol 166(8):851–861. doi:10.1016/j.jplph.2008.11.007 25. Sun W, Bernard C, Van De Cotte B, Van Montagu M, Verbruggen N (2001) At-HSP17.6A, encoding small heat-shock protein in Arabidopsis, can enhance osmotolerance upon overexpression. Plant J 27(5):407–415. doi:10.1046/j.1365-313X. 2001.01107.x 26. Jiang C, Xu J, Zhang HAO, Zhang X, Shi J, Li MIN, Ming F (2009) cytosolic class I small heat shock protein, RcHSP17.8, Rosa chinensis confers resistance to variety stresses to Escherichia coli, yeast and Arabidopsis thaliana. Plant Cell Environ 32(8):1046–1059. doi:10.1111/j.1365-3040.2009.01987.x 27. Schmidt R, Schippers JHM, Welker A, Mieulet D, Guiderdoni E, Mueller-Roeber B (2012) Transcription factor OsHsfC1b regulates salt tolerance and development in Oryza sativa ssp. japonica. AoB Plants 0:pls011 28. Cho E, Hong C (2006) Over-expression tobacco NtHSP70-1 contributes to drought-stress tolerance in plants. Plant Cell Rep 25(4):349–358. doi:10.1007/s00299-005-0093-2 29. Almoguera C, Jordano J (1992) Developmental and environmental concurrent expression sunflower dry-seed-stored lowmolecular-weight heat-shock protein and Lea mRNAs. Plant Mol Biol 19(5):781–792. doi:10.1007/bf00027074 30. Coca M, Almoguera C, Thomas T, Jordano J (1996) Differential regulation small heat-shock genes in plants: analysis water-stress-inducible and developmentally activated sunflower promoter. Plant Mol Biol 31(4):863–876. doi:10.1007/ bf00019473 31. Colmenero-Flores J, Campos F, Garciarrubio A, Covarrubias* (1997) Characterization Phaseolus vulgaris cDNA clones responsive to water deficit: identification novel late embryogenesis abundant-like protein. Plant Mol Biol 35(4):393–405. doi:10.1023/a:1005802505731 32. Campbell JL, Klueva NY, Zheng H-g, Nieto-Sotelo J, Ho THD, Nguyen HT (2001) Cloning new members heat shock protein HSP101 gene family in wheat (Triticum aestivum (L.) Moench) inducible by heat, dehydration, and ABA. Biochim Biophys Acta Gene Struct Expression 1517(2):270–277. doi:10. 1016/s0167-4781(00)00292-x 33. Heikkila J, Papp JET, Schultz G, Bewley JD (1984) Induction heat shock protein messenger RNA in maize mesocotyls by water stress, abscisic acid, and wounding. Plant Physiol 76(1):270–274 34. Vitale A, Bielli A, Ceriotti (1995) The binding protein associates with monomeric phaseolin. Plant Physiol 107(4):1411–1418 35. Forreiter C, Kirschner M, Nover L (1997) Stable transformation an Arabidopsis cell suspension culture with firefly luciferase providing cellular system for analysis chaperone activity in vivo. Plant Cell Online 9(12):2171–2181 36. Lee GJ, Roseman AM, Saibil HR, Vierling E (1997) small heat shock protein stably binds heat-denatured model substrates and can maintain substrate in folding-competent state. EMBO J 16(3):659–671 37. Lee GJ, Pokala N, Vierling E (1995) Structure and in vitro molecular chaperone activity cytosolic small heat shock proteins from pea. J Biol Chem 270(18):10432–10438 ´ 38. Dat J, Vandenabeele S, Vranova E, Van Montagu M, Inze D, Van Breusegem F (2000) Dual action active oxygen species during plant stress responses. Cell Mol Life Sci 57(5):779–795 39. Luke MM, Sutton A, Arndt KT (1991) Characterization SIS1, Saccharomyces cerevisiae homologue bacterial dnaJ proteins. J Cell Biol 114(4):623–638 40. Qi Y, Wang H, Zou Y, Liu C, Liu Y, Wang Y, Zhang W (2011) Over-expression mitochondrial heat shock protein 70 suppresses programmed cell death in rice. FEBS Lett 585(1):231–239 41. Nieto-Sotelo J, Kannan K, Martinez L, Segal C (1999) Characterization maize heat-shock protein 101 gene, HSP101, encoding ClpB/Hsp100 protein homologue. Gene 230(2):187 123