GENE-39391; No. of pages: 7; 4C:
Gene xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

Gene
journal homepage: www.elsevier.com/locate/gene

Identification of a Bombyx mori gene encoding small heat shock protein
BmHsp27.4 expressed in response to high-temperature stress
Hua Wang a, Yan Fang a, Zhongzan Bao a, Xing Jin a, Wenjuan Zhu a, Lipeng Wang a, Teng Liu a, Haipeng Ji a,
Haiying Wang a, Shiqing Xu a,b, Yanghu Sima a,b,⁎
a
b

Department of Applied Biology, School of Biology and Basic Medical Sciences, Medical College of Soochow University, China
National Engineering Laboratory for Modern Silk, Soochow University, China

a r t i c l e

i n f o

Article history:
Accepted 6 January 2014
Available online xxxx
Keywords:
Bombyx mori
Small heat shock protein
Prokaryotic expression
Immunofluorescence

a b s t r a c t
Elucidating the mechanisms underlying the response and resistance to high-temperature stress in the
Lepidoptera is essential for understanding the effect of high-temperature on the regulation of gene expression.
A tag (CATGAACGTGAAGAGATTCAG) matching the predicted gene BGIBMGA005823-TA in SilkDB identified
the most significant response to high-temperature stress in a screen of the heat-treated digital gene expression
library of Bombyx mori (B. mori) (Unpublished data). BLAST and RACE showed that the gene is located on
chromosome 5 and has an open reading frame (ORF) of 741 bp. Phylogenetic analysis found that B. mori small
heat shock protein 27.4 (BmHSP27.4) is in an evolutionary branch separate from other small heat shock proteins.
Expression analysis showed that BmHsp27.4 is highly expressed in brain, eyes and fat bodies in B. mori. Its mRNA
level was elevated at high-temperature and this increase was greater in females. The ORF without the signal
peptide sequence was cloned into vector pET-28a(+), transformed and over-expressed in Escherichia coli
Rosetta (DE3). Western blotting and immunofluorescence analysis with a polyclonal antibody, confirmed
that the level of protein BmHSP27.4 increased at a high-temperature, in accordance with its increased mRNA
level. In this study, BmHsp27.4 was identified as a novel B. mori gene with an important role in response to
high-temperature stress.
© 2014 Elsevier B.V. All rights reserved.

1. Introduction
Heat shock proteins (Hsps) are members of a class of proteins highly
expressed in organisms and cells in response to a variety of external
stresses, including high-temperature, viral infection and starvation.
Hsps, which are highly expressed in a range of tissues under hightemperature stress conditions, have an important role in protecting
cells from damage (Cara et al., 2005; Carranco et al., 1997; Landais
et al., 2001; Tammariello et al., 1998).
Bombyx mori is an economically important insect and serves as a valuable model organism. Hsps are divided according to their molecular size,
Abbreviations: ACD, α-Crystallin protein; B. mori, Bombyx mori; BCA, Bicinchoninic
acid; BmHsp27.4, Bombyx mori small heat shock protein 27.4; cAMP, Cyclic Adenosine
monophosphate; cDNA, Complementary deoxyribonucleic acid; cGMP, Guanosine 3′,5′cyclophosphate; DAPI, 4′,6-diamidino-2-phenyindole; ELISA, enzyme linked immunosorbent assay; EST, expressed sequence tag; FITC, fluorescein isothiocyanate; GRAVY, grand
average hydropathicity; IPTG, isopropyl-β-d-thiogalactopyranoside; mRNA, messenger ribonucleic acid; NCBI, National Center for Biotechnology Information; ORF, open reading
frame; PDB, Protein Data Bank; PVDF, polyvinylidene difluoride membrane; qRT-PCR,
quantitative real-time RT-PCR; RACE, rapid amplification of cDNA ends; sHsp, small heat
shock protein; SilkDB, Silkworm Genome Database; WB, Western blotting.
⁎ Corresponding author at: Department of Applied Biology, School of Biology and Basic
Medical Sciences, Medical College of Soochow University, Suzhou 215123, China.
Fax: +86 0512 65880255.
E-mail address: simyh@suda.edu.cn (Y. Sima).

structure and function into Hsp60, -70, -90 and -110 and small Hsp
(sHsp), a low molecular mass protein of 15–30 kDa that represents a
large class of functional proteins widespread in prokaryotes and eukaryotes
(Kim et al., 1998; Norimine et al., 2004; Sugiyama et al., 2000). Sciandra and
Subjeck (1983) suggested that sHsp serves as a chaperone in processes such
as protein folding, aggregation, membrane transport and decomposition
(Boston et al., 1996; Xu et al., 2011).
BmHsp19.9, -21.4, -23.7, -25.4, -27.4 and Hsp1 genes have been
cloned and confirmed to have important functions in vivo. Their expression can be induced to various extents by exposure to high-temperature
(Li et al., 2009; Sakano et al., 2006; Sheng et al., 2010). B. mori was treated with ecdysone and rutin and the transcriptional level of BmHsp19.9
was changed, indicating sHsp acted as a molecular chaperone and
underwent an increase in expression levels in response to heat stimulation (Xia et al., 2007). BmHsp23.7 was highly expressed in the midgut
of animals infected by cytoplasmic polyhedrosis viruses. Moreover,
different types of virus, time of infection and varieties of B. mori tested
led to differences in expression of responsive genes (Wu et al., 2011).
The BmHsp genes encode B. mori sHsps and have important roles in
thermal reactions (Howrelia et al., 2011; Li et al., 2012). In this study, we
isolated a new gene that encodes a 27.4 kDa B. mori sHsp by screening
the differential gene expression library of B. mori at high-temperature
and at a common temperature. We then cloned the gene and performed
a bioinformatics and expression analysis.

0378-1119/$ – see front matter © 2014 Elsevier B.V. All rights reserved.
http://dx.doi.org/10.1016/j.gene.2014.01.021

Please cite this article as: Wang, H., et al., Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in
response to high-temperature stress, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.01.021

2

H. Wang et al. / Gene xxx (2014) xxx–xxx

2. Materials and methods
2.1. Bioinformatics web sites and software
SilkDB (silkworm.genomics.org.cn/) was used for chromosomal
localization of the gene. EST and gene sequence alignment were
done with BLAST on the National Center for Biotechnology Information (NCBI) website (blast.ncbi.nlm.nih.gov/), and the open reading
frame (ORF) was searched using the ORF Finder at NCBI (www.
ncbi.nlm.nih.gov/gorf/gorf.html). The amino acid composition,
molecular mass and isoelectric point were predicted using the
Protparam tool (web.expasy.org/protparam/). The transmembrane domain of the protein was predicted using DAS (www.sbc.su.se/~miklos/
DAS/); the signal peptide was predicted using the SignalP 3.0 Server
(www.cbs.dtu.dk/services/SignalP/); and the protein secondary
structure was predicted using an online tool of SAS (www.ebi.ac.uk/
thornton-srv/databases/sas/). Post-translational modification sites of
the protein were predicted using Motif-scan (hits.isb-sib.ch/cgi-bin/
motif_scan). Protein modeling and the prediction of its tertiary
structure were done with the Swiss-model (swissmodel.expasy.org//
SWISS-MODEL.html) and its subcellular distribution was predicted
using PSORT Prediction (psort.hgc.jp/form2.html) and TargetP (www.
cbs.dtu.dk/services/TargetP/). The amino acid accumulation map
was made with Weblogo (weblogo.berkeley.edu/). The EST-based
gene expression profile was obtained from the EST Profile (www.ncbi.
nlm.nih.gov/unigene/).
2.2. Phylogenetic analysis
Phylogenetic analysis was performed on the multiple alignments of
heat shock protein amino acid sequences. Sixteen Hsps from other
species and nine BmHsps from B. mori were included. The analysis
was performed using ClustalX and manual refinement. Phylogenetic
trees were constructed using the Neighbor-Joining method, provided
by the MEGA5.1 software, under the Poisson correction amino acid substitution model. Boot-strapping was performed 1000 times to obtain
support values for each branch. The Pfam program was used to identify
the motifs found in the Hsp proteins (Lu et al., 2012). The sequence
logos for conservative analysis of α-Crystallin protein (ACD) were
obtained by submitting alignment sequences to the website http://
weblogo.berkeley.edu/logo.cgi (Crooks et al., 2004).
2.3. Insects and culture conditions
B. mori variety 7532 with resistance to high-temperature was used
in this study. Larvae were reared on fresh mulberry leaves (Morus sp.)
at 26–27 ºC with a photoperiod of 12 h light/12 h dark. The 5th instar
larvae were selected and males and females were reared separately.
The experimental larvae were exposed to high-temperature (34 ºC)
for 24 h and the control group was maintained at 26 ºC. The fat body
was dissected and then ground and stored in liquid nitrogen.

Table 1
Primers for preparation of cloned and prokaryotic expression.
Primer name

Sequence (5′ → 3′)

EST-S
EST-A
3′ RACE outer
3′ RACE GSP1
3′ RACE inner
3′ RACE GSP2
5′ RACE outer
5′ RACE GSP1
5′ RACE inner
5′ RACE GSP2
qPCR-S
qPCR-A
Prokaryotic expression-S
Prokaryotic expression-A
Actin 3 (A3)-S
Actin 3 (A3)-A

GTCTTACTAGCCGTTGCG
ACAAGGGCGTAGTCCAAT
TACCGTCGTTCCACTAGTGATTT
GAAGTGCGAGCGATTTACAA
CGCGGATCCTCCACTAGTGATTTCACTATAGG
AAAGCCAGAAGCCACAACAG
CATGGCTACATGCTGACAGCCTA
TCATTTGCGATTATTTGCGG
CGCGGATCCACAGCCTACTGATGATCAGTCGATG
CGACCTTGTGTCTTCTGCTCT
ACCGCCACCACCAGAAAGA
GTCGCCTCAGCCAAATCCA
CG GAATTC CAGAGCAGAAGACACAAGGT EcoRI
CG AAGCTT TCACTCGGAATCTGGTT HindIII
CTGCGTCTGGACTTGGC
CGAGGGAGCTGCTGGAT

Quantitative real-time RT-PCR (qRT-PCR) was used to analyze the
levels of mRNA from the BmHsp27.4 gene after heat treatment. A SYBR
Premix Ex Taq (Perfect Real Time; TaKaRa) kit was used, in accordance
with the manufacturer's instructions. The reaction volume was 20 μL,
and the cycling conditions were as follows: denaturation for 1 min at
95 ºC and 45 cycles of 95 ºC for 5 s, 55 ºC for 10 s and 72 ºC for 10 s.
Three replicates were tested for each sample and the data were
corrected using the Sequence Detection program (v.1.3.1).
2.5. Construction and expression of the prokaryotic expression plasmid of
pET28a-BmHsp27.4
The prokaryotic expression primers excluding the signal peptide
sequence (amino acids 1–19) were designed (Table 1) according to
the complete ORF sequence of the BmHsp27.4 gene. The upstream and
downstream primers contained EcoRI and HindIII restriction sites, respectively. Two endonucleases were used to cleave BmHsp27.4-T-vector
and pET28a (+). The target bands were cloned into pET28a (+) via T4
DNA ligase (Fermentas, Canada) and transformed to competent Rosetta
(DE3). Verified clones were selected and transferred to 500 mL of
Fresh LB medium and incubated for another 3 h, then isopropyl-β-Dthiogalactopyranoside (IPTG; Sango, China) was added to a final
concentration of 1 mM and incubated for 8 h at 25 °C. The fusion proteins were recovered and purified by an affinity Ni column specific to
His-tailed proteins. The polyclonal antibody was recovered, purified
and prepared as previously described (Yang et al., 2012).
2.6. Western blotting (WB)

2.4. Cloning of a complete cDNA sequence and production of gene
expression profiles
EST sequence amplification primers were used to amplify the EST
sequences (Table 1). The 5′ and 3′ rapid amplification of cDNA ends
was done using the 5′ and 3′ Full RACE kits (TaKaRa, Japan) with 5′
and 3′ RACE outer and inner primers. Total RNA was isolated from the
fat body using Trizol® (Life Technologies, Carlsbad, CA) reagent and
RNA concentrations were determined by spectrophotometry (Beckman,
USA). The PCR products were examined by electrophoresis in 1% (w/v)
agarose gel and stained with ethidium bromide. The selected PCR
products were purified with the Agarose Gel DNA Purification Kit
(TaKaRa, Japan), cloned into vector pMD19-T (TaKaRa, Japan) and
sequenced by Invitrogen (Carlsbad, CA).

Proteins were extracted from the fat body at different time points.
Protein concentrations were measured using a BCA Protein Assay Kit
(Beyotime, China) and a microplate reader. The extracts were subjected
to SDS-PAGE (12% (w/v) polyacrylamide gel) and transferred electrophoretically to polyvinylidene difluoride membrane (PVDF). The
membrane was blocked with a blocking solution (Beyotime, China),
followed by incubation with the purified anti-BmHsp27.4 antibody or
the anti-β-tubulin antibody, washed and then incubated with horseradish peroxidase (HRP)-labeled anti-mouse IgG (Bioworld Technology,
USA). Proteins were visualized using the EZ-ECL Chemiluminescence
Detection Kit for HRP (Biological Industries, Israel).
2.7. Immunofluorescence
After treatment for 72 h, the fat body was placed onto ice and fixed
in 4% (v/v) paraformaldehyde. The samples were dehydrated in an ethanol series, then embedded in paraffin and sections (8–10 μm thick)
were cut with a microtome. Paraffin sections of the silk glands were

Please cite this article as: Wang, H., et al., Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in
response to high-temperature stress, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.01.021

H. Wang et al. / Gene xxx (2014) xxx–xxx

3

dewaxed with xylene, rehydrated in an ethanol series then subjected to
an antigen unmasking procedure by heating in sodium citrate buffer
(Beyotime, China) for 15 min and cooled. Sections were incubated for
1 h with a blocking solution and then incubated overnight at 4 ºC with
the anti-BmHsp27.4 antibody or the anti-β-tubulin antibody or normal
rabbit serum as a negative control. Sections were washed three times
(5 min each time) with PBST (Beyotime, China) then incubated with
an appropriate fluorescein isothiocyanate (FITC)-conjugated secondary
antibody (CWBIO, China) for 30 min at 37 ºC. Sections were washed
three times (5 min each time) with PBST then stained with 4′,6diamidino-2-phenyindole (DAPI; Beyotime, China). Reference sections
were stained with rabbit negative serum as a primary antibody. All sections were examined under an OlympusBX51 fluorescence microscope
(Olympus, Japan).

of it being located in the secretory pathway was 0.845 and it was located
in the cytoplasm. Together, these results suggest that it is a secretory
protein.
Analysis of the secondary structure of the BmHSP27.4 protein, by
SAS, indicated that the α helix, β fold and random coil contents were
32.52%, 27.64% and 39.84%, respectively (Fig. 2B). The 3D structure of
the protein was predicted by SWISS-MODEL (Fig. 2C). We found a protein homologous with alignment length 175 and corresponding PDB ID:
2ygd, which encodes the 24 meric Eye Lens Chaperone α-Crystallin
protein (ACD) as an important human molecular chaperone (Braun
et al., 2011). The BmHSP27.4 protein and this homolog showed 32.4%
identity, with 57.7% coverage.

3. Results

Analysis of the homology of sHSP27 with other species showed that
BmHsp27.4 belongs to a single branch with a large genetic distance. Furthermore, its homology with invertebrate sHSP27 differed significantly
compared to vertebrate sHSP27 (Fig. 4A). Phylogenetic analysis of the
cloned members of the B. mori sHsp family showed that B. mori sHsp exhibited a significant gradient branch (Fig. 4B), which might be because
the B. mori sHsp family evolved from highly homologous proteins. sHsp
contains a conserved ACD at the C terminus, which can produce a large
number of oligomers, preventing damage caused by protein aggregation
when serving as a chaperone (Crack et al., 2002). Our results also indicate
that HSP27 of different species and the B. mori sHsp family both contain
ACD composed of the most conserved amino acids (Figs. 4C and D). However, the base stacking diagram (amino acids 73–149) showed the ACD of
HSP27 in different species (Fig. 4C) was more conservative compared to
the B. mori sHsp family (Fig. 4D), which might be an important reason
for functional differences between different sHsp species.

3.1. Gene information
A 709 bp target EST sequence was obtained by qRT-PCR (Fig. 1A)
and the cloning strategy, which was based on the sequence
BGIBMGA005823-TA, is shown in Fig. 2A. A 410 bp 3′ RACE product
and a 106 bp 5′ RACE product were obtained. The gene sequence of
BmHsp27.4 is accession number KF547930 in GenBank. The full length
of the gene sequence is 940 bp with a 741 bp ORF (from base pair 34774) encoding a protein containing 246 amino acid residues (Fig. 2B).
The BLASTN analysis detected no intron in the cloned gene. The gene
was located at nscaf2838:1796002-1796742(+ strand) on chromosome 5.
3.2. Bioinformatics analysis of the novel gene BmHsp27.4
The BmHSP27.4 protein (molecular mass 27.4173 kDa theoretical pI
5.86) contains 246 amino acids. The instability index was 45.07, which
is classified as unstable. Motif-scan analysis was used to obtain 13
hits: two N-myristoylation sites; six protein kinase C phosphorylation
sites; four casein kinase II phosphorylation sites; and one cAMP and
cGMP-dependent protein kinase phosphorylation site (Fig. 3). The
grand average hydropathicity (GRAVY) value, as predicted by ProtScale,
was −0.409, which indicated that it is a hydrophilic protein. Analysis by
Dense Alignment Surface showed only one transmembrane structure
(6–15 amino acids) of the BmHSP27.4 protein. Using SignalP and
TargetP, it had a predicted signal peptide with 20 amino acid residues
in the N terminus causing them to be secreted from the cell. The score

3.3. Homologous alignment and phylogenetic tree

3.4. Gene expression profile of BmHsp27.4 and response to
high-temperature stress
The UniGene ID of BmHsp27.4 is Bmo.4295 (www.ncbi.nlm.nih.gov/
UniGene/ESTProfileViewer.cgi?uglist=Bmo.4295), so we obtained the
corresponding EST profile of the gene by the EST Database. Under
normal circumstances, BmHsp27.4 is expressed mainly before the silk
spinning stage and is highly expressed in the pupal and embryo stages,
but the expression level is low in the larval stage (Fig. 1C). Expression
levels of the gene in different tissues in decreasing order are brain,
maxilla, testis, eye and fat body (Fig. 1B). Considering most Hsps can
be induced by high-temperature and the fat body is an important site

Fig. 1. Cloning method production and EST expression profiles. (A) Results of PCR amplification. (B) Digital expression profiles of BmHsp27.4 in different tissues. (C) Expression levels of
different developmental stages. The corresponding UniGene number for the BmHsp27.4 gene was Bmo.4295.

Please cite this article as: Wang, H., et al., Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in
response to high-temperature stress, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.01.021

4

H. Wang et al. / Gene xxx (2014) xxx–xxx

Fig. 2. Cloning strategy and protein structure analysis. (A) Cloning strategy. First, the spliced EST sequences were amplified using PCR, and the 5′ and 3′ RACE primers on both sides of the
EST sequences were designed. The 5′ and 3′ RACE products were 106 bp and 410 bp in length, respectively, and were spliced with the EST sequence to obtain the gene sequence with a full
length of 940 bp. The black frame is the ORF. (B) Prediction of protein secondary structure. (C) Prediction of the protein 3D structure based on 2ygd:T.

of energy metabolism in B. mori, we investigated gene expression in the
fat body at high-temperature. The results showed that, similar to other
sHsp genes, BmHsp27.4 could be induced by high-temperature, and
the expression levels were increased with treatment time at high-

temperature. However, the expression level showed a downward
trend after day 6. The results also showed that, during various periods
of time, the gene expression levels in B. mori males were higher
compared to females (Fig. 6A).

Fig. 3. Amino acid sequence analysis, Motif-scan was used to analyze the motifs and 13 hits were found.

Please cite this article as: Wang, H., et al., Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in
response to high-temperature stress, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.01.021

H. Wang et al. / Gene xxx (2014) xxx–xxx

5

Fig. 4. Comparison of homology comparison and phylogenetic tree. (A) Phylogenetic trees of sHSP27 of different species. The phylogenetic tree was created by the neighbor joining (NJ)
method, using Mega4.0. The protein sequences of BmHSP27.4 homologs were retrieved from the following species (GenBank ID), Canis lupus (AAA87172.1), Mus musculus (AAA18335.1),
Homo sapiens (AAB51056.1), Bos taurus (NP 001020740.1), Capra hircus (AFK93550.1), Alligator mississippiensis (BAF94137.1), Xenopus laevis (ABF17872.1), Platichthys flesus (CCO03033.
1), Gymnocephalus cernuus (CCO03019.1), Poeciliopsis lucida (AAB46593.1), Larimichthys crocea (ADX98507.1), Thunnus orientalis (BAH59273.1), Ceratitis capitata (ACD76913.1),
Drosophila melanogaster (AAA28638.1), Culex quinquefasciatus (XP 001847191.1), Brachionus ibericus (ADR79277.1), (B) Homology analysis of cloned sHsp in B. mori. The other of
B. mori heat shock protein sequences used were: Hsp20.8 (ACM24338.1), Hsp20.4 (AAG30945.2), Hsp19.9 (BAD74195.1), Hsp20.1 (BAD74196.1), Hsp21.4 (BAD74197.1), Hsp23.7
(BAD74198.1), Heat shock protein 1 (ABF51459.1), Hsp25.4 (ACA25336.1), Hsp22.6 (ACM24354.1). (C) Conservative analysis of ACD of sHSP27 in different species (D) Conservative
analysis of ACD and sHsp cloned from B. mori.

3.5. Western blot and immunofluorescence analysis of protein expression
The target gene with a length of 687 bp after removal of the signal
peptide was cloned and connected to the high efficiency expression
vector pET28a (+). SDS-PAGE and western blot detections showed
that the fusion target protein was detected only in the supernatants
after centrifugation, indicating that the fusion protein was soluble

(Fig. 5A). ELISA assays showed the polyclonal antibodies had a titer of
1:51200. The western blot assays showed that the polyclonal antibodies
had high specificity (Figs. 5B and C).
The results of the western blots showed that the transcriptional
levels were consistent with the translational levels, reaching a peak at
day 5 and then decreasing (Fig. 6B). Similarly, the protein levels in
male silkworms were higher compared to females. Subsequently, the
localization of BmHSP27.4 proteins in the fat body under hightemperature was done on day 5, which showed that the proteins were
localized outside the nuclei (Fig. 6C) and the normal is only a low
lever (figure not shown).

4. Discussion

Fig. 5. Construction and expression of the prokaryotic expression plasmid, pET28aBmHSP27.4. (A) The prokaryotic expression vector with the target gene. Lane 1, the
empty vector; lane 2, the vector with the target gene. (B) SDS-PAGE of proteins after
induction. Lane 1, the empty vector; lane 2, BmHSP27.4-pET28a (+) whole bacterial liquid
after induction; lane 3, supernatant after sonication; and lane 4, precipitate after sonication. (C) Western blot assays of proteins after induction using the His-tag antibody as
the secondary antibody for validation. Lanes 1–4 have the same material as in (B). Lanes
M are molecular mass markers.

The synthesis of Hsps in insects can be induced by low or hightemperature. The speed of acquiring heat resistance is positively
correlated with the rate of Hsp accumulation, and the decrease of heat
resistance is synchronized with Hsp degradation (Boston et al., 1996;
Sakano et al., 2006).
BmHsp27.4 has some characteristics in common with the B. mori
sHsps investigated earlier. First, the gene sequence contains only one
exon and has no intron, which is suitable for the rapid expression of
large quantities of sHsps and prevention of the impact of severe thermal
shock on pre-mRNA splicing (Sheng et al., 2010). Second, the protein
sequence contains a conserved 77 amino acid α-Crystallin domain
(MacRae, 2000), which can prevent undesired interactions between
proteins and help the refolding of denatured protein (Haslbeck, 2006).
In addition, Hsps have thermal reactivity; some proteins also have

Please cite this article as: Wang, H., et al., Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in
response to high-temperature stress, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.01.021

6

H. Wang et al. / Gene xxx (2014) xxx–xxx

Fig. 6. Expression of gene and protein in response to high-temperature stress. (A) Expression levels of the BmHsp27.4 gene in the fat body in a high-temperature environment. After feeding
for 24 h, B. mori 5th instar larvae in the experimental group were transferred to 34 ºC (control group 26 ºC) and sampled once every 24 h. B. mori actin A3 was used as the internal reference
gene. The BmHsp27.4/A3 ratio represented the relative gene expression level of BmHsp27.4. (B) BmHSP27.4 protein expression in a high-temperature environment. (C) Localization of the
BmHSP27.4 protein in the fat body under high-temperature stress. Column 1, genomic DNA labeled with DAPI; column 2, BmHSP27.4 (green fluorescence) stained by the anti-BmHSP27.4
antibody and FITC; column; 3, merged images for FITC and DAPI. Diagrams 1′, 2′ and 3′ show amplified sections (yellow frames) of 1, 2 and 3. Yellow arrowheads indicate genomic DNA.
The scale bars represent 50 μm. The expression data were downloaded from the EST database and the calculation was: TPM (transcript per million) expression values (pool) = Gene EST/
Total EST in pool. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

important roles in other adverse environments (Sakano et al., 2006).
BmHSP27.4 constitutes an independent and relatively primitive branch
in the phylogenetic tree of the sHsp of B. mori or other species.
The prokaryotic expression of the BmHSP27.4 protein was found to
be highly expressed only in the E. coli Rosetta (DE3) strain, but not in
the normal BL21 strain (DE3). Rare codon analysis found that the translation initiation site contained a leucine residue (CTA) and could not be
expressed in BL21 (DE3). However, it had a good expression in Rosetta
(DE3) and could be expressed only in the viral supernatant, indicating
good solubility. sHsps with Cys are prone to form interchain disulfide
bonds that affect correct folding, leading to aggregation (Fu et al.,
2003). Therefore, these proteins often exist in the form of inclusion bodies. The BmHSP27.4 protein sequence has only one Cys and thus cannot
form a disulfide bond.
Both PCR and western blot assays showed that BmHsp27.4 gene transcription and expression levels at high-temperature were higher in
males compared to females. Sorensen et al. (2007) found a significant
difference between male and female fruitflies in the adaptability of
Hsps to high-temperature in both the initial and at the late stages. It is
known that high-temperature resistance is significantly higher in male

compared to female silkworms (Traut et al., 2007). The subcellular localization of BmHsp25.4 under normal circumstances is mainly in the
cytoplasm and starts to appear in the membrane after a heat shock
(39 ºC) for 3 h, suggesting that the transfer of BmHsp25.4 to the cell
membrane could maintain its mobility and integrity (Sheng et al.,
2010). The subcellular localization of BmHSP27.4 protein indicates
that it is distributed mainly in the cytoplasm at high-temperature.
However, the question of whether BmHSP27.4 has the same function
as BmHsp25.4 remains to be answered.
Conflict of interest
There is no conflict of interest.
Acknowledgments
The authors gratefully acknowledge the financial support from the
earmarked fund for China Agriculture Research System (CARS; grant
no. CARS-22-ZJ0104), Priority Academic Program Development of

Please cite this article as: Wang, H., et al., Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in
response to high-temperature stress, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.01.021

H. Wang et al. / Gene xxx (2014) xxx–xxx

Jiangsu Higher Education Institutions, and the Research Innovative Projects for average college graduate students of 2011 in Jiangsu Province,
China.
Database:
PDB ID:2ygd (http://www.rcsb.org/pdb/explore.do?structureId=
2ygd)
References
Boston, R.S., Viitanen, P.V., Vierling, E., 1996. Molecular chaperones and protein folding in
plants. Plant Mol. Biol. 32, 191–222.
Braun, N., et al., 2011. Multiple molecular architectures of the eye lens chaperone alphaBcrystallin elucidated by a triple hybrid approach. Proc. Natl. Acad. Sci. U. S. A. 108,
20491–20496.
Cara, J.B., Aluru, N., Moyano, F.J., Vijayan, M.M., 2005. Food-deprivation induces HSP70
and HSP90 protein expression in larval gilthead sea bream and rainbow trout.
Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 142, 426–431.
Carranco, R., Almoguera, C., Jordano, J., 1997. A plant small heat shock protein gene
expressed during zygotic embryogenesis but noninducible by heat stress. J. Biol.
Chem. 272, 27470–27475.
Crack, J.A., Mansour, M., Sun, Y., MacRae, T.H., 2002. Functional analysis of a small heat
shock/alpha-crystallin protein from Artemia franciscana. Oligomerization and
thermotolerance. Eur. J. Biochem. 269, 933–942.
Crooks, G.E., Hon, G., Chandonia, J.M., Brenner, S.E., 2004. WebLogo: a sequence logo generator. Genome Res. 14, 1188–1190.
Fu, X., Li, W., Mao, Q., Chang, Z., 2003. Disulfide bonds convert small heat shock
protein Hsp16.3 from a chaperone to a non-chaperone: implications for the
evolution of cysteine in molecular chaperones. Biochem. Biophys. Res. Commun.
308, 627–635.
Haslbeck, M., 2006. Recombinant expression and in vitro refolding of the yeast small heat
shock protein Hsp42. Int. J. Biol. Macromol. 38, 107–114.
Howrelia, J.H., Patnaik, B.B., Selvanayagam, M., Rajakumar, S., 2011. Impact of temperature on heat shock protein expression of Bombyx mori cross-breed and effect on
commercial traits. J. Environ. Biol. 32, 99–103.
Kim, K.K., Kim, R., Kim, S.H., 1998. Crystal structure of a small heat-shock protein. Nature
394, 595–599.
Landais, I., et al., 2001. Characterization of the cDNA encoding the 90 kDa heat-shock
protein in the Lepidoptera Bombyx mori and Spodoptera frugiperda. Gene 271,
223–231.

7

Li, Z.W., Li, X., Yu, Q.Y., Xiang, Z.H., Kishino, H., Zhang, Z., 2009. The small heat shock
protein (sHSP) genes in the silkworm, Bombyx mori, and comparative analysis with
other insect sHSP genes. BMC Evol. Biol. 9, 215.
Li, J., Moghaddam, S.H., Du, X., Zhong, B.X., Chen, Y.Y., 2012. Comparative analysis on the
expression of inducible HSPs in the silkworm, Bombyx mori. Mol. Biol. Rep. 39,
3915–3923.
Lu, W., et al., 2012. Identification and characterization of fructose 1,6-bisphosphate
aldolase genes in Arabidopsis reveal a gene family with diverse responses to abiotic
stresses. Gene 503, 65–74.
MacRae, T.H., 2000. Structure and function of small heat shock/alpha-crystallin proteins:
established concepts and emerging ideas. Cell. Mol. Life Sci. 57, 899–913.
Norimine, J., Mosqueda, J., Palmer, G.H., Lewin, H.A., Brown, W.C., 2004. Conservation of
Babesia bovis small heat shock protein (Hsp20) among strains and definition of T
helper cell epitopes recognized by cattle with diverse major histocompatibility
complex class II haplotypes. Infect. Immun. 72, 1096–1106.
Sakano, D., et al., 2006. Genes encoding small heat shock proteins of the silkworm,
Bombyx mori. Biosci. Biotechnol. Biochem. 70, 2443–2450.
Sciandra, J.J., Subjeck, J.R., 1983. The effects of glucose on protein synthesis and
thermosensitivity in Chinese hamster ovary cells. J. Biol. Chem. 258, 12091–12093.
Sheng, Q., Xia, J., Nie, Z., Zhang, Y., 2010. Cloning, expression, and cell localization of a
novel small heat shock protein gene: BmHSP25.4. Appl. Biochem. Biotechnol. 162,
1297–1305.
Sorensen, J.G., Kristensen, T.N., Kristensen, K.V., Loeschcke, V., 2007. Sex specific effects of heat
induced hormesis in Hsf-deficient Drosophila melanogaster. Exp. Gerontol. 42, 1123–1129.
Sugiyama, Y., et al., 2000. Muscle develops a specific form of small heat shock protein
complex composed of MKBP/HSPB2 and HSPB3 during myogenic differentiation.
J. Biol. Chem. 275, 1095–1104.
Tammariello, S.P., Denlinger, D.L., 1998. Cloning and sequencing of proliferating cell
nuclear antigen (PCNA) from the flesh fly, Sarcophaga crassipalpis, and its expression
in response to cold shock and heat shock. Gene 215, 425–429.
Traut, W., Sahara, K., Marec, F., 2007. Sex chromosomes and sex determination in
Lepidoptera. Sex.Dev. 1, 332–346.
Wu, P., et al., 2011. Microarray analysis of the gene expression profile in the midgut of
silkworm infected with cytoplasmic polyhedrosis virus. Mol. Biol. Rep. 38, 333–341.
Xia, Q., et al., 2007. Microarray-based gene expression profiles in multiple tissues of the
domesticated silkworm, Bombyx mori. Genome Biol. 8, R162.
Xu, Q., Zou, Q., Zheng, H., Zhang, F., Tang, B., Wang, S., 2011. Three heat shock proteins from
Spodoptera exigua: gene cloning, characterization and comparative stress response during heat and cold shocks. Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 159, 92–102.
Yang, Y., Wang, B., Yang, D., Lu, M., Xu, Y., 2012. Prokaryotic expression of woodchuck
cytotoxic T lymphocyte antigen 4 (wCTLA-4) and preparation of polyclonal antibody
to wCTLA-4. Protein Expr. Purif. 81, 181–185.

Please cite this article as: Wang, H., et al., Identification of a Bombyx mori gene encoding small heat shock protein BmHsp27.4 expressed in
response to high-temperature stress, Gene (2014), http://dx.doi.org/10.1016/j.gene.2014.01.021